pTi plasmid backbone

Open DNA Collections Shared Reagents
1

pTi

This is the new plasmid backbone that @FernanFederici’s lab has developed for the Research in Diagnostics Collection after we had some trouble with expression with pOpenv3. We already handed out some plasmid to a few people and I invite them to post a bit about their experience here (@YHK). I also invite Fernan and his lab to share some info about the plasmid here as well.

I will update this with info of my own experiments trying to express the collection’s proteins here, as soon as I get around to that.

Thanks to you all!

3 Likes
2

Thanks @fxbuson to create this pTI expression plasmid topic :dizzy:
Also, is good to know you have shared it to other labs and would be awesome to have some feedback from them.

pTI general information

(plasmid sequence available here)
As mentioned before this plasmid was designed as a golden gate BsaI acceptor and expression vector. It includes:

i) Cloning module: composed by a LacZ expression cassette which is removed after an effective golden gate assembly :arrow_right: in a blue/white assay, colonias which doesn’t insert the assembled enzyme gene will be blue :negative_squared_cross_mark:. It is flanked by BsaI recognition sites and A(GGAG) - F(CGCT) standard level 1 assembly syntax sequences.

ii) Verification motifs: The clonning module is flanked by UNSes sequences (Torella et al., 2014) to allow standard sequencing verification (though U1F/UXR primers) or any other PCR downstream procedure of interest.

U1F: cattactcgcatccattctcaggctg
UXR: GGTGGAAGGGCTCGGAGTTGTGG

iii) LacI regulation: It has constitutive expression of LacI repressor to allow lac box regulated promoters (e.g. pLac or pT7_lac0) protein production, and enhance the T7RNAP regulation included in λDE3 lysogen (minimizing leacky expression of T7RNAP). The LacI gene expression is preciselly leveled to perform this tasks.

iv) Mainteinance elements: Kanamycin resistance cassette to perform the selection and keep the plasmid. Kanamycin usage agrees with the assembly plasmid hierachy requirements, is cheap, broadly used/available and has an optimal performance. Replication machinery is composed of pBR322 plus ROP gene to keep a low plasmid copy number.

v) Upper uLoop level assembly elements: Additionally, between cloning module and UNSes, there are uLoop even assembly schemas that could be used to include the enzyme expression cassette in downstream SapI multiple gene assemblies.

pTI_Schema
pTI_Schema1417×683 68.1 KB

Mode of use

Once use this plasmid as assembly aceptor vector, and transform the production reaction in E. coli competent cells, you have to plate them in culture media supplemented with kanamycin at 50 μg/mL, X-Gal at 40 μg/mL, and IPTG 0.2 μmol/mL. This last one is necessary to have expresion of the LacZ negative selection marker.
Then you have to select some white colonies (e.g. 3 colonies) and perform a propper assembly verification method like colony PCR or sequencing. If everthing is correct, you can transform the obtained plasmid in your expression strain and carry controled overexpression by induction with IPTG.

I hope it is clear :slight_smile:

3 Likes
3

Expression Performance

In general terms, the vector behavior of the vector is expected to be similar to the popular vector pET28a as they have the same plasmid replication machinery (pBR322 plus ROP gene) and the same lacI gene (with gtg start codon to improve the regulation without increasing the toxicity). In other words, the plasmid copy number, the amount of lacI repressor, and the T7RNAP level relation with the copies of the gene to be overexpressed are as in the pET28a expression system.

We characterize LacI regulation of pTI vector by cloning sfGFP reporter protein under pLac promoter and observed optimal performance (wide dynamic range and minimal leaky expression). Moreover, we try out some combinations of collection elements to carry out the expression of sfGFP in BL21 strain, aiming to find a workhorse set of them to overexpress enzymes of interest with standard requirements and facilities. It is: AB_pT7_Lac0 + BN1_Riboj54_B0034_His_tag + N1C_GS_linker + CD_Enzyme_Coding_Sequence + DE_3xStop + EF_Tz terminator, assembled in pTI acceptor vector.

Characteristics:

  • Improved T7 promoter with a LacI box which boost its regulation
  • RiboJ insulator to reduce the RBS activity variation given by the different 5’UTR that surround it in each particular assembled sequence.
  • B0034 middle strength RBS
  • 6x Histag to carry out the purification in Histrap columns
  • 12 residues GS flexible linker
  • improved T7 RNAP transcriptional terminator (Tz)

With this arrangement we have carried out the over-expression and purification of sfGFP, BstLF and HIV-RT successfully :metal:

2 Likes
4

Unfortunately, I didn’t have a successful transformation with the two pTi plasmids that I currently have. I am planning to retry it with the material I have still left, but I don’t have the place to do that yet.
I will post my update here.

5

Thanks for flagging this @ykh! Maybe we should send you fresh plasmid for another try. Could you confirm which enzymes you were expressing?

I think @joseph_shenekji had recent experience trying transformations with pOBL and pTi. Which version worked for you in the end?

Jenny

6

Little re-correction here: I think @jenny_molloy may have mistyped me (YKH) when tagging for @YHK!
(Not the first time this has happened xD )

Apologies for the delay in replying to you, Yann (I hope that’s correct?) - we’ve been juggling a lot of things for Reclone behind the scenes recently, but hopefully we can share more in the near future.

As Jenny says, let us know which enzymes you’re testing, and hopefully we can help a bit more.

@FernanFederici @Isaac_N and @fxbuson also have good experience with working with pTi - perhaps @YHK, you can give more details with what DNA sequences you’re working with, the strain you’re transforming the pTi plasmids into, and any other details that might be helpful, and they may be able to provide you with more support?

Please feel free to directly message me your contact details and we can make arrangements to send you fresh plasmids also.

Best wishes, Yan Kay

7

yes, indeed i did a transformation to top10 and DH5a with pTi & pOBL and till now i only exressed with pOBL an enzyme with 90 KDa with 2300 bp length and it works just fine, i wil let you know about the pTi once i try it, but the strain that worked for me is BL21 Rosetta it gave better results then other strains.
@jenny_molloy @YKH

1 Like
8

Hi I am working on expression of the Open Enzymes set in E. coli. Would it be possible to get pTi plasmid to experiment with? I run a nonprofit lab in New York and we have a project going to be a source for the Open Enzymes collection and take it further, funded through Experiment.com. My email is ejorgensen@biotechwithoutborders.org.

Thanks so much for this great forum!

Ellen

1 Like
9

Hi @EJorgensen

Thanks for getting in touch! And congratulations on the funding from Experiment.com.
@osn_scott previously shared with us your project and it’s definitely a direction that we want to take the collections in!
Do let us know how we can contribute!
For those who aren’t familiar, Ellen and her collaborators project is: Democratize Biotech! Can community labs jumpstart distributed production/distribution of critical biotech tools?

We’d be happy to share the pTi plasmid with you - can you give us more details via our ordering form? (pTi isn’t currently on the list, so do note it in the “special request” section.)

If you’re free, it’ll be great to see you at our Community Meeting tomorrow (Reclone Community Meeting on January 17th 2024 at 14:00 UTC ✨ - #2 by cibele) where we’ll be updating on current and upcoming projects, and how the community can get involved.

Best wishes,
Yan Kay

10

Hi everyone, following up on what Isaac posted, we think it would be useful to let everyone know what we’re doing with the plasmid.

We’re trying to verify that it’s a good backbone for our protein expression systems, specifically trying to express proteins from the Research in Diagnostics Collection (RiDC, previously Molecular Diagnostics Toolkit). The version they’re in right now should be “ready-to-express”, but wasn’t expressing quite as much as we would like. We’ve seen some promising results by just exchanging the entire insert gene from some RiDC plasmids to pTi, so we’re currently working on exchanging backbones for the rest of the collection.

2 Likes
11

I’ve had problems trying to join your meetings. I’m always stuck in a waiting room and never get to join. It could be something I’m doing wrong. Do you have any suggestions?

12

Hi @EJorgensen

I’m sorry that you’ve been having problems joining the meetings.

I believe there might have been a confusion in the meeting start times: our usual meeting times are at 14:00 UTC on the second Wednesday of the month. Though I realise we did change the time last month, and the date this month in order to accommodate for end of year/start of year madness!

We normally try to include the date/time using the Forum settings and an arewemeetingyet link when we email/post out the event, as these should give the appropriate time for your time zone. There is also an “Add this event to your Calendar” link on the https://reclone.org/meetings/ site, which should add the event to your Google Calendar (if you use that).

My apologies if we forgot to add the links/make appropriate changes this time.

We have plans to set up a Calendar on the Forum too, so hopefully that’ll reduce any further time mix-ups!

For now, if you go to https://forum.reclone.org/t/reclone-community-meeting-on-january-17th-2024-at-14-00-utc/875/2, you’ll be able to see the slides from the meeting yesterday, and we’ll be sharing the recording and a summary of the meeting there too within the next week.

Let me know if there’s anything else I can do to help in the meantime!

P.s. thanks for filling in the order request form – we’ll be in touch within the next week too to begin the order process.